| The selected flanking sequence (T-DNA_LB.GK-624B07-022001) is bold high-lighted in the flanking sequence table below |
| Line | |
| Line Identifier |
T-DNA.GK-624B07-022001 |
| Class |
T-DNA |
| Ecotype |
Columbia |
| Source |
Weisshaar B. et al., Max-Planck-Institut fuer Zuechtungsforschung |
| Pedigree
|
|
| NASC stock code |
|
|
ABRC stock code |
|
|
Ordering Info |
(http://www.mpiz-koeln.mpg.de/GABI-Kat/) |
| Flanking Sequence(s) | |
| Line Identifier |
T-DNA_LB.GK-624B07-022001 |
| Accession |
BX657443 (EMBL record) (NCBI record) |
| Primer direction |
LB |
| Mapping Score |
2 (FAQ) |
| Chromosome
|
3 |
| Insert Position |
6148113 |
| Insert Validation |
One-click WU-BLASTN |
| Orientation |
L->R |
| Sequence |
TCCGGACAGCTTTTTGGTAAGCATAAGAATCCCAGCGAGACCTAAACCTA |
| Length |
50 |